circad | circRNAs associated with diseases

circDNMT1
Gene	DNMT1	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	29973691
Experimental Method
Sample Type	Cell Lines	Comparison	eight breast cancer cell lines in patients vs normal
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACCCTCCTGCCTCAGCCTCCCAAG Reverse GTGCTTTTCCTTGTAATCCTGGGG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Du, WW, Yang, W, Li, X, Awan, FM, Yang, Z, Fang, L, Lyu, J, Li, F, Peng, C, Krylov, SN, Xie, Y, Zhang, Y, He, C, Wu, N, Zhang, C, Sdiri, M, Dong, J, Ma, J, Gao, C, Hibberd, S, Yang, BB (2018). A circular RNA circ-DNMT1 enhances breast cancer progression by activating autophagy. Oncogene, 37, 44:5829-5842.